| Primary Identifier | MGI:5817225 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Glyctk |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Glyctk-8207J-M5437 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGAACTTCCAGCTGAGGAG, GGGGTGCCCCGAGTACCATA, GTAAGAGTCTATGGGCGCAG and GGTCTGGCCTGGTTTCTAAA, which resulted in a 457 bp deletion beginning at Chromosome 9 negative strand position 106,157,473 bp, CGCAGGGGGACGCCCTCTAC, and ending after GGTTGGTCACCTCTCCTCAG at 106,157,017 bp (GRCm38/mm10). This mutation deletes exon 3 and 305 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 114 amino acids later. |
