| Primary Identifier | MGI:7432300 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ect2l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCAGGAAAAGGCTTAAA and GCTGGGTAAGTGTCTCAAGG, which resulted in a 499 bp deletion beginning at Chromosome 10 position 18,173,871 bp and ending after 18,174,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615953 (exon 4) and 246 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 10amino acids later. There is a 4 bp insertion at the deletion site (TGAA). |
