Primary Identifier | MGI:6293920 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Scfd2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTCTGGGCTGCCTCCGCAG and ATCAAGTTAATACTTCCCAG, which resulted in a 220 bp deletion beginning at Chromosome 5 position 74,482,133 bp and ending after 74,482,352 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000227750 (exon 3) and 92 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 335 and early truncation 22 amino acids later. There is a single bp (T) insertion at the deletion site. |