Primary Identifier | MGI:6208811 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Ctif |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGACATCTGACAAAAAAGG and GGTGTCAGCGAGGGCCCCAG, which resulted in a 183 bp deletion beginning at Chromosome 18 position 75,611,693 bp and ending after 75,611,875 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000423004 (exon 4) and 109 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 8 amino acids later. |