Primary Identifier | MGI:6257435 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Abat |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6N |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA, 2 guide sequences TGTTGTGGTCTGCCTAATGTGGG, CCATTGTGAAGGCTTCAAAGGTG, and a non-contributing oligo, which resulted in a Exon Deletion. |