| Primary Identifier | MGI:6316167 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccnb1ip1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0410 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCAATACCTTGGTCTTTCCA and TTTGCAATTATCGGAAGTGT targeting the 5' side and ATCCCGCAGTCTGGAGTCTT and ACCACAGTAAACTGAGCTGT targeting the 3' side of exons ENSMUSE00000617176 and ENSMUSE00000617175 resulting in a 2,141 bp deletion of Chr14 from 50791871 to 50794011 (GRCm38). |
