| Primary Identifier | MGI:5897852 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Apol8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Apol8-8505J-5445F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAAGCTGAGAGCCATCGGA, ACTGGGTGAGGAAGACACGG, TGGTCCCACCTAAGGAGGCG and TCCCAACACCAGCTCTCCAG, which resulted in a 522 bp deletion beginning at Chromosome 15 negative strand position 77,753,103 bp, GCTCTCCAGGGGTGGGTGTC, and ending after AAGCTGAGAGCCATCGGAAG at 77,752,582 bp (GRCm38/mm10). This mutation deletes exon 3 and 395 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 10 and early truncation 42 amino acids later. |
