| Primary Identifier | MGI:6385181 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gprasp2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGGGGCAGAAGTTGAGAC and AATCAAAATGATCCCGAGGA, which resulted in a 2449 bp deletion beginning at Chromosome X position 135,841,913 bp and ending after 135,844,361 bp (GRCm38/mm10). This mutation deletes 2449 bp from ENSMUSE00000935837 (exon 7) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 9 amino acids later. |
