|  Help  |  About  |  Contact Us

Allele : Cd36<em1(IMPC)Mbp> CD36 molecule; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis

Primary Identifier  MGI:6276959 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cd36
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at UC Davies by injecting and 2 guide sequences GGCCATCCTTTGATACGAGGAGG, CCCTTAGTCAACAAAACAGTAAG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele