Primary Identifier | MGI:6294912 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Specc1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGAGAAGATACCTAGAGG and GTAAATTACATCAGATGATA, which resulted in a 2002 bp deletion beginning at Chromosome 11 position 62,117,560 bp and ending after 62,119,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000238537 (exon 4) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 10 amino acids later. |