| Primary Identifier | MGI:6316188 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hgsnat |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0251 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence GCAGGTTAACTCCACCTCGG resulting in a 17-bp deletion from Chr8:25971594 to 25971578 (GRCm38). |
