| Primary Identifier | MGI:6276291 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc51 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCTGTCAGTGGTTATTCG and ATTGCTTCCCGTGAATAAAA, which resulted in a 1297 bp deletion beginning at Chromosome 9 position 109,091,430 bp and ending after 109,092,726 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000352186 (exon 4) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 156 and early truncation 9 amino acids later. |
