Primary Identifier | MGI:5897838 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Kri1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Kri1-8530J-910M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCAGCTGCCAGTTCCCGA, ACAGGCCCTGAGCCACCCTC, GCAGAGAATGCAATAGGGCA and GGGCGAGTACCATATAGCCC, which resulted in a 356 bp deletion beginning at Chromosome 9 negative strand position 21,285,546 bp, GGGCTATATGGTACTCGCCC, and ending after AGTTCCCGAGGGACCCTGAG at 21,285,191 bp (GRCm38/mm10). This mutation deletes exon 4 and 229 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 25 amino acids later. |