|  Help  |  About  |  Contact Us

Allele : Ret<em3Heno> ret proto-oncogene; endonuclease-mediated mutation 3, Hideki Enomoto

Primary Identifier  MGI:7484391 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Ret
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Methionine codon 919 (ATG) was changed to threonine (ACC) (p.M919T) using an sgRNA (targeting CCGGATTCCCGTCAAGTGGATGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.M918T mutation associated with multiple endocrine neoplasia type 2B (MEN2B).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Ret<M919T>,
  • Ret<M919T>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories