| Primary Identifier | MGI:6515784 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pdzd8 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 1 was targeted with two sgRNAs (targeting GCAGGCCGAGGGTTGCGGCGGGG and GCAGATTCCCAGCACGACCCTGG) and crRNA and tracrRNA using CRISPR/Cas9 technology. Immunohistochemistry confirmed the lack of peptide expression from this allele in brain. |
