|  Help  |  About  |  Contact Us

Allele : Trem2<em1Tcp> triggering receptor expressed on myeloid cells 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6739869 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Trem2
Is Recombinase  false Is Wild Type  false
molecularNote  A G-to-A mutation was introduced to change arginine codon 47(CGC) to a histidine codon (CAC) (p.R47H) using an sgRNA (targeting ACTGGGGGAGACGCAAGGCC) and an ssODN template (CTGCAGGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTTATGACGCCTTGAAGCACTGGGGGAGACaCAAGGCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGC) with CRISPR/Cas9 technology. The mutation has been indicated as an Alzheimer's Disease risk factor.
  • mutations:
  • Single point mutation
  • synonyms:
  • R47H TREM2,
  • R47H TREM2
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories