| Primary Identifier | MGI:6094836 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Clrn3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATACCTGGAATGGACTCAG, ATGGGTGTCTATACCTGGAA, CACCAGGTGCAAAGACTTCT and CCAGAAGTCTTTGCACCTGG, which resulted in a 157 bp deletion beginning at Chromosome 7 negative strand position 135,518,605 bp and ending after 135,518,449 bp (GRCm38/mm10). This mutation creates an internal deletion of ENSMUSE00000341796 (exon 2) and is predicted to cause a change of amino acid sequence after residue 84 and a stop 108 amino acids later. |
