| Primary Identifier | MGI:7488215 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | St6galnac1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 319 (CGA) was changed to glutamine (CAA) (p.R319Q) using an sgRNA (targeting CCGGTATGTTCTCCCTCCGTTGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of a human mutation associated with inflammatory bowel disease (IBD). |
