Primary Identifier | MGI:6156116 | Allele Type | Endonuclease-mediated |
Attribute String | Conditional ready | Gene | Syt7 |
Strain of Origin | C57BL/6NTac | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 3 guide sequences CCTGTAAACTATATCATCCACGG, GGGGGAGACTGTTACAGGCTAGG, TTGAGGGGGGAGACTGTTACAGG, and a donor oligo, which resulted in a Conditional Ready allele. |