| Primary Identifier | MGI:6477990 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gcn1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGAGCAGGGCTCAGCA and GCTGGTGTAGAGCCACTGGT, which resulted in a 1611 bp deletion beginning at Chromosome 5 position 115,574,333 bp and ending after 115,575,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249622, ENSMUSE00001219534(exons 3 and 4) and 1415 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 11 amino acids later. |
