Primary Identifier | MGI:7366891 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Ndrg1 |
Strain of Origin | C57BL/6N | Is Recombinase | false |
Is Wild Type | false |
molecularNote | CRISPR/Cas9 technology using sgRNAs GGGCCAACAACTTCCCATTCTGG and GTGTGACACCCCTTGTCTTGGGG generated an approximate 3.5 kb deletion encompassing exons 4 and 5. Western blot analysis confirmed the absence of protein in the sciatic nerve. |