| Primary Identifier | MGI:6377433 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tsen54 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAAATCCCATCTACGGTGG and GAAAGTGGATGCTTAGACGA, which resulted in a 1008 bp deletion beginning at Chromosome 11 position 115,820,077 bp and ending after 115,821,084 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304729 and ENSMUSE00000109206 (exons 7 and 8) and 280 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 15 amino acids later. |
