|  Help  |  About  |  Contact Us

Allele : Podxl<em1(IMPC)H> podocalyxin-like; endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6153807 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Podxl
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TTTCCTTAGAGTGTCCAGCCAGG, CTGCCCAGGGGTCAGAATAGAGG, GACGGTCCCTGCTTATCAACAGG, CCAAGGTCACAGGGCACAACCGC, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele