| Primary Identifier | MGI:5696236 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp579 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp579-7041J-M1234 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CGGAAAGCTTTGGGGCACAG and CCAAGAGCACGCAGGTAGCG, which resulted in a 1 bp T insertion in exon 1 beginning at Chromosome 7 positive strand position 49,94,713bp (GRCm38/mm10). This mutation results in a change of amino acid sequence after amino acid residue 78 and early truncation 49 amino acid residues later. In addition, 141 bases after the T insertion there is an 8 bp deletion GTAGCGAG, which does not appear to affect the result of the insertion. |
