| Primary Identifier | MGI:5823470 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tbc1d8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tbc1d8-8160J-M2435 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGGTGCTAAGTACCCCT, ACACTTTTGCTTAATTACAT, CCTTCAGTCTAACTGTTGTC and GTAAGAACCCAACCTTGTTT, which resulted in a 449 bp deletion beginning at Chromosome 1 negative strand position 39,405,659 bp, AACAAGGTTGGGTTCTTACA, and ending after GGTACTTAGCACCGCTTCCG at 39,405,211 bp (GRCm38/mm10). This mutation deletes exon 4 and 220 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp deletion (AC) 80 bp before the 449 bp deletion that will not effect the results of this deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 3 amino acids later. |
