|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(ACE2)Brle> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Brendan Lee

Primary Identifier  MGI:7628005 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, Inserted expressed sequence Gene  Gt(ROSA)26Sor
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/Cas9 endonuclease-genome editing, a guide RNA [ACTCCAGTCTTTCTAGAAGA (PAM: TGG)] was selected to introduce a loxP-flanked STOP (with stop codons in all 3 reading frames and a triple polyA signal) cassette, human angiotensin converting enzyme 2 (ACE2) cDNA, and a polyA signal sequence, into the Gt(ROSA)26Sor locus.
  • mutations:
  • Insertion
  • synonyms:
  • Rosa26<hACE2>,
  • Rosa26<hACE2>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

1 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories