Primary Identifier | MGI:6156154 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Rlim |
Strain of Origin | C57BL/6NTac | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences CCTCTTCCCGATCCAAGCGATCC, TTCTGCGCTGAGCTGCAGACTGG, which resulted in a Indel. |