|  Help  |  About  |  Contact Us

Allele : Gykl1<em1Juhu> glycerol kinase-like 1; endonuclease-mediated mutation 1, Junjiu Huang

Primary Identifier  MGI:6359760 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gykl1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A single base insertion of an A was created using an sgRNA (AGCGGGAAACTACGATAGTC) and CRISPR/Cas9 technology, creating a null allele.
  • mutations:
  • Insertion
  • synonyms:
  • Gykl1<->,
  • Gykl1<->,
  • Gykl1 KO,
  • Gykl1 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele