| Primary Identifier | MGI:6188980 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hspd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTACAACGAATGTAATAAAA, GGTGGCATCTGTTAGTACCA, AAGACAACAGAATTCTTTAC and TTGAGATTCATGTTGCAGGA, which resulted in a 469 bp deletion beginning at Chromosome 1 position 55,084,501 bp and ending after 55,084,969 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374725 (exon 3) and 216 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (G) at the deletion site as well as an indel with a 5 bp insert (GTCTC) and 4 bp deletion (TTAT) 29 bp after the 469 bp deletion that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 58 and early truncation 1 amino acid later. |
