|  Help  |  About  |  Contact Us

Allele : Ralgps1<em1(IMPC)J> Ral GEF with PH domain and SH3 binding motif 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6188291 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ralgps1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAACAGCCTTCTCCAACCA, CCCAACATAGATCTCTGTGA, GGATAGGAACACTAGTGAGG and ACTTCTATCCAGGGTTTGAT, which resulted in a 524 bp deletion beginning at Chromosome 2 position 33,260,322 bp for 139 bp then a 7 bp (GTTGTGG) endogenous retention followed by an additional 385 bp deletion ending after 33,260,852 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000603840 (exon 8) and 397 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 6 bp deletion (ACTCTC) 19 bp before the 524 bp deletion as well as a 5 bp deletion (GTGGAG) 31 bp after the 524 bp deletion, neither of which are expected to alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 161 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele