Primary Identifier | MGI:6314387 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Papola |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAATGGTTGTTAGTAAAGCA and GAATTGTCCATAGACCACAG, which resulted in a 373 bp deletion beginning at Chromosome 12 position 105,804,899 bp and ending after 105,805,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214864 (exon 4) and 291 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 24 amino acids later. There is a 15 bp insertion (ACTCCCAAAACCAG) at the deletion site. |