|  Help  |  About  |  Contact Us

Allele : Papola<em1(IMPC)J> poly (A) polymerase alpha; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6314387 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Papola
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAATGGTTGTTAGTAAAGCA and GAATTGTCCATAGACCACAG, which resulted in a 373 bp deletion beginning at Chromosome 12 position 105,804,899 bp and ending after 105,805,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214864 (exon 4) and 291 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 24 amino acids later. There is a 15 bp insertion (ACTCCCAAAACCAG) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele