|  Help  |  About  |  Contact Us

Allele : Tusc3<em1(IMPC)J> tumor suppressor candidate 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5659636 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tusc3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tusc3-6898J-M247 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GATGGGAGTGAATCCAAGGG, ACGATCATGGAGTAGTTCCG and ATCTCGCTCTAAGTCTAAGT, which resulted in a 106 bp deletion beginning in exon 2 at Chromosome 8 positive strand position 39,046,620 bp, at CGGAACTACTCCATGATCGTCATG, and ending after CCTTGAGAAAAGCAGCAGCCTA at position 39,046,725 bp in intron 3 (GRCm38). This mutation deletes 64 bp in exon 2 and 42 bp into intron 3 removing the splice donor site. This mutation is predicted to cause an early truncation after amino acid residue 81 and early truncation after amino acid residue 83. In addition there is a 23 bp deletion in intron 2 (AAGGGAGGAACACCCTGTAACTT) Chromosome 8 positive strand position 39,046,469 - 39,046,492 bp, which is not predicted to affect the amino acid sequence.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tusc3<em1J>,
  • Tusc3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories