| First Author | Robert B | Year | 1995 |
| Journal | Mouse Genome | Volume | 93 |
| Issue | 4 | Pages | 1044-1046 |
| Mgi Jnum | J:30571 | Mgi Id | MGI:78687 |
| Citation | Robert B, et al. (1995) Refined genetic localisation of MSX2 on mouse Chr 13. Mouse Genome 93(4):1044-1046 |
| abstractText | Full text of Mouse Genome contribution: REFINED GENETIC LOCALISATION OF MSX2 ON MOUSE CHR 13. Benoit Robert1 and Ana Brunialti2. 1 Genetique Moleculaire du Developpement et URA 1947 du CNRS and 2 Genetique des Mammiferes, Institut Pasteur, 28 rue du Dr. Roux 75724 Paris Cedex 15 France. Introduction Msx2 is a homeobox gene from a small multigene family in vertebrates(1, 2). It was recently allocated to mouse Chr 13 by a multipoint linkage analysis which involved D13Mit3, D13Mit7 and Hmgcr as markers(3). These loci are relatively distant from Msx2, the closest one, D13Mit7 being located at 8.3 +/- 4.0 cM on the telomeric side. We have undertaken a refined analysis with RI strains, using SSCP(4) defined between the parental strains of these RI sets. We have extended published results from the BXD set(1) and further analysed the BXH and the AXB, BXA sets. In addition, we have analysed the segregation of Msx2 in animals from the European Backcross(5). From our results, Msx2 maps close and centromeric to Il9, in a region where the dumpy (dpy) mutation is found(6). Material and Methods DNA samples from the BXD, BXH, AXB and BXA RI strains were purchased from the Jackson Laboratory. A 259 bp PCR amplification fragment was produced mostly from the 3' untranslated region of the Msx2 gene(1) using the oligonucleotides 5' ATGCCACGCCGCTTGGATAT 3' and 5' GTGAGAGGAAAGGGGGCATTTG 3' as the forward and reverse primers, respectively. Amplification was conducted on 100 ng of genomic DNA for 30 cycles with 30 sec of denaturation at 94 degrees C, 1 min of annealing at 56.7 degrees C and 20 sec of elongation at 72 degrees C. For labelling, 1 uCi of alpha-32P dCTP (Amersham, 3000 Ci/mmole) were added to 5 ul of amplified products in a final volume of 10 ul, and the mixture was further amplified for 10 cycles under the same conditions. The reaction was then diluted to 150 ul with 0.1% SDS and 20 mM EDTA. Two ul of the dilution were combined with 2 ul of formamide loading dye, denatured at 100 degrees C for 3 min, loaded without delay on a 6% polyacrylamide/bis- acrylamide (19/1) gel and electrophoresed at 300 volts over-night. Results were analysed using the Map Manager program(7). To analyse the progeny from the European Backcross, a polymorphic microsatellite (CAAA)n was defined in the promoter region of Msx2(3) between C57BL/6 and SEG using two oligonucleotides as primers: 5' TTGCAAAGTCGAACCCTGTT 3' and 5' TCACCCCTTGAGTCTCCTCTC 3'. These amplify a 198 bp fragment in the DNA of C57BL/6 and an approximately 220 bp one in that of SEG. Amplification was as above except that hybridisation temperature was 58 degrees C. D13Mit13 segregation was analysed using the D24 oligonucleotides(8) as PCR primers under the same conditions with hybridisation at 55 degrees C. PCR products were analysed on 3% NuSieve: 1% Seakem GTG agarose gels. Results Segregation of Msx2 in RI strains Single-strand conformation polymorphisms for Msx2 were identified between the C57BL/6 (B) and C3H (H), C57BL/6 and DBA/2 (D), C57BL/6 and AJ (A) progenitor strains. These polymorphisms were used to study the segregation of Msx2 in the BXD, BXH, AXB and BXA recombinant inbred strains (Table 1). Analysis of the BXD set was completed by identifying the alleles carried at the Il9 locus in strains 1, 30, 31 and 32, using the polymorphic marker D13Mit13, which is a (CA)n microsatellite located in the third exon of Il9(8). From this analysis, Msx2 maps very close to Il9, with which it recombines only once in the BXH set of RI strains. This single recombination event suggests that Msx2 is centromeric to Il9. Table 1. AXB, BXA: D13Mit10; 1: A; 2: B; 3: A; 4: A; 5: B; 6: B; 7: B; 8: B; 9: B; 10: A; 11: B; 12: B; 13: A; 14: A; 15: A; 17: B; 18: A; 19: A; 20: A; 21: B; 23: B; 24: A; B1: B; B2: A; B4: A; B7: B; B8: A; B9: A; B11: B; B12: A; B13: B; B14: A; B16: B; B17: A; B18: A; B20: B; B22: B; B23: A; B24: B; B25: A; B26: A; 95%: 0.2; 5.5. AXB, BXA: D13Nds1; 1: A; 2: B; 3: A; 4: A; 5: B; 6: B; 7: B; 8: B; 9: B; 10: A; 11: B; 12: B; 13: B; 14: A; 15: A; 17: B; 18: A; 19: A; 20: A; 21: B; 23: B; 24: A; B1: B; B2: B; B4: A; B7: B; B8: A; B9: A; B11: B; B12: A; B13: B; B14: A; B16: B; B17: A; B18: A; B20: B; B22: B; B23: A; B24: B; B25: A; B26: A; 95%: 0.2; 5.5. AXB, BXA: Msx2; 1: A; 2: B; 3: A; 4: A; 5: B; 6: B; 7: B; 8: B; 9: B; 10: A; 11: B; 12: B; 13: A; 14: A; 15: A; 17: B; 18: A; 19: A; 20: A; 21: B; 23: B; 24: A; B1: B; B2: B; B4: A; B7: B; B8: A; B9: A; B11: B; B12: A; B13: B; B14: A; B16: B; B17: A; B18: A; B20: B; B22: B; B23: A; B24: B; B25: A; B26: A; 95%: 0.0; 4.0. AXB, BXA: D13Mit13/Il9; 1: A; 2: B; 3: A; 4: A; 5: B; 6: B; 7: B; 8: B; 9: B; 10: A; 11: B; 12: B; 13: A; 14: A; 15: A; 17: B; 18: A; 19: A; 20: A; 21: B; 23: B; 24: A; B1: B; B2: B; B4: A; B7: B; B8: A; B9: A; B11: B; B12: A; B13: B; B14: A; B16: B; B17: A; B18: A; B20: B; B22: B; B23: A; B24: B; B25: A; B26: A; 95%: 0.0; 2.5. AXB, BXA: D13Mit7; 1: A; 2: B; 3: A; 4: A; 5: B; 6: A; 7: B; 8: A; 9: B; 10: A; 11: A; 12: B; 13: A; 14: A; 15: A; 17: B; 18: A; 19: A; 20: A; 21: B; 23: B; 24: A; B1: B; B2: B; B4: A; B7: B; B8: A; B9: A; B11: B; B12: A; B13: B; B14: A; B16: A; B17: A; B18: A; B20: A; B22: B; B23: B; B24: B; B25: B; B26: B; 95%: 2.5; 18.3. AXB, BXA: Xmv13; 1: A; 2: B; 3: A; 4: A; 5: B; 6: A; 7: B; 8: A; 9: A; 10: B; 11: A; 12: B; 13: A; 14: A; 15: A; 17: A; 18: A; 19: A; 20: A; 21: B; 23: B; 24: A; B1: B; B2: B; B4: A; B7: B; B8: A; B9: A; B11: B; B12: A; B13: B; B14: B; B16: A; B17: A; B18: A; B20: A; B22: B; B23: B; B24: B; B25: B; B26: B; 95%: 0.7; 8.9. BXD: Msx2; 1: B; 2: D; 5: B; 6: D; 8: B; 9: D; 11: B; 12: D; 13: D; 14: D; 15: B; 16: D; 18: B; 19: B; 20: D; 21: D; 22: B; 23: B; 24: D; 25: D; 27: D; 28: D; 29: B; 30: D; 31: D; 32: D. BXD: D13Mit13/Il9; 1: B; 2: D; 5: B; 6: D; 8: B; 9: D; 11: B; 12: D; 13: D; 14: D; 15: B; 16: D; 18: B; 19: B; 20: D; 21: D; 22: B; 23: B; 24: D; 25: D; 27: D; 28: D; 29: B; 30: D; 31: D; 32: D; 95%: 0.0; 4.1. BXH: Max2; 2: B; 3: B; 4: B; 6: H; 7: H; 8: H; 9: H; 10: H; 11: B; 12: H; 14: B; 19: B. BXH: Il9; 2: B; 3: B; 4: B; 6: H; 7: H; 8: H; 9: H; 10: H; 11: B; 12: H; 14: B; 19: H; 95%: 0.1; 22.8. BXH: Xmv13; 2: B; 3: H; 4: B; 6: H; 7: H; 8: H; 9: H; 10: H; 11: B; 12: H; 14: B; 19: H; 95%: 0.1; 22.8. Table 1: (Legend). Segregation of polymorphic alleles in three different sets of RI strains. The segregation profile of Il9 in the BXA set is as defined by Mu et al. (9) using the D13Mit13 polymorphic marker. In the rows on the right are indicated the minimal and maximal genetic distances between adjacent markers with a 95% confidence according to the binomial law. Segregation of Msx2 in the progeny of the European Backcross. To further investigate the linkage between Msx2 and Il9, the segregation of the two genes was analysed in animals from the European Backcross(5). Segregation data were compared with those of D13Mit10, a marker known to map 4 cM from Il9 on the centromeric side(9). Thirty five recombinants were observed between D13Mit10 and Msx2 out of 847 animals analysed, and 23 out of 691 between Msx2 and D13Mit13. A three-point analysis confirmed that Msx2 is located between these two markers, and centromeric to Il9, since this order gives no double recombinant between D13Mit10, Msx2 and Il9 (Table 2). Distances between these markers are [2.90-5.70 cM] and [2.12-4.95 cM], respectively, in a 95% confidence interval. Discussion From our analysis, the Msx2 gene is located between D13Mit10 and Il9 on mouse Chr 13, at about 4 cM of each of these markers. This location is in good agreement with the compilatory map of Justice and Stephenson(9) and anchors Msx2 to the Chr 13 map in relation to the reference marker Il9. For this analysis, we have used the profile proposed by Mu et al. (10) for the segregation of Il9 in the BXA panel of RI strains. The segregation profile published by Mock et al. (11) differs from the former for two strains, although the probes used in both cases derive from the Il9 gene. These differences introduce two double recombination events for Il9 in these two strains relative to adjacent genetic markers, including Msx2, as already noted by Mu et al.(10). Using the segregation profile defined by Mu et al.(10), we observe no recombination event between Il9 and Msx2 in the AXB and BXA RI strains. This linkage analysis places Msx2 in a region where the dumpy (dpy) mutation has been mapped(6). The mutants are characterised by a short snout and shortened middle and inner metatarsals and hallux. These are structures for which Msx2 is supposed to play a role 2,12,13. Furthermore, a recently described disease in human, which most likely is due to a point mutation in the MSX2 gene, results in craniosynostosis and metatarsal anomalies(14). From the genetic location of Msx2 and the analogy in phenotype between this craniosynostosis and dumpy, dpy might be an allele of Msx2. The mutation, however, is most likely extinct (W. Hollander, personal communication). Table 2. D13Mit10; 1; 1; 2; 2; 1; 2; 2; 2; 1. Msx2: 1; 1; 2; 2; 2; 1; 1; 2; 1. D13Mit13: 1; ?; 2; ?; 2; 1; ?; 1; 2. #: 286; 75; 349; 79; 18; 15; 2; 12; 11. Table 2 : (Legend). Segregation of Msx2 and linked markers in the EUCIB. For each marker, the alleles are designated as 1 or 2, according to whether they both come from the same progenitor, or one from C57BL/6 and the other from M. spretus, respectively. A ? means that the alleles were not defined at the given locus for the corresponding animals. Close to Msx2 and Il9 is found Gpcr15, a G-protein-coupled receptor gene which probably encodes the dopamine 1A receptor(15). Interestingly, Msxl is located on mouse Chr 5 between Il6 and Gpcrl, the likely gene for dopamine 1B receptor(15-17). This suggests a paralogy between the chromosomal regions carrying Msxl and Msx2, respectively. It is worth noting, however, that the gene order for Il9, Msx2 and Gpcrl5 has not been experimentally defined on mouse Chr 13, and that in human, Il6 maps to chromosome 7p15-7p21(18) while Msxl and the dopamine 1B receptor gene (DRD1B) are located on chromosome 4p(15). Acknowledgements: We are grateful to Christophe Poirier for sharing some of the DNA preparations, and to Drs. J. L. Guenet and M. Buckingham for support and encouragement. References 1. Monaghan, A.P., et al. (1991). Development 112, 1053-1061. 2. Robert, B., Lyons, G., Simandl, B.K., Kuroiwa, A. and Buckingham, M. (1991). Genes Dev. 5, 2363-2374. 3. Bell, J.R., et al. (1993). Genomics 16, 123-131. 4. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K. and Sekiya, T. (1989). Proc. Natl. Acad. Sci. (USA) 86, 2766-2770. 5. Breen, M., et al. (1994). Hum. Mol. Genet. 3, 621-627. 6. Hollander, W.F. (1981). J. Hered. 72, 358-359. 7. Manly, K. (1993). Mamm. Genome 4, 303-313. 8. Dietrich, W., et al. (1992). Genetics 131, 423-447. 9. Justice, M.J. and Stephenson, D.A. (1994). Mamm. Genome 5, S196-S206. 10. Mu, J.-L., Naggert, J.K., Nishina, P.M., Cheah, Y.-C. and Paigen, B. (1993). Mam. Genome 4, 148-152. 11. Mock, B.A., et al. (1990). Immunogenetics 31, 265-270. 12. Takahashi, Y., Bontoux, M. and LeDouarin, N.M. (1991). Embo J. 10, 2387-2393. 13. Mina, M., Gluhak, J., Upholt, W.B., Kollar, E.J. and Rodgers, B. (1995). Dev. Dyn. 202, 195-214. 14. Jabs, E.W., et al. (1993). Cell 75, 443-450. 15. Wilkie. T.M., et al. (1993). Genomics 18, 175-184. 16. Hill, R.E., et al. (1989). Genes Dev 3, 26-37. 17. Robert, B., et al. (1994). Mamm. Genome 5, 446-449. 18. Fergusson-Smith, A.C., et al. (1988). Genomics 2, 203-208. |
