Primary Identifier | MGI:7539038 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Utp18 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATGGTTCCTGACTACCAA and CTAAAGACCGCAGTAGACAA, which resulted in a 665 bp deletion beginning at Chromosome 11 position 93,883,396 bp and ending after 93,884,060 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001307179 (exon 2) and 549 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 108 and early truncation 1 amino acids later. |