Primary Identifier | MGI:6377462 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Galntl6 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACATTGGTAATCAACAA and TTTATGGCTGGAGTTGTGGG, which resulted in a 459 bp deletion beginning at Chromosome 8 position 58,535,773 bp and ending after 58,536,231 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001303502 (exon 3) and 350 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 35 amino acids later. |