Primary Identifier | MGI:6382545 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Ccdc40 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCACAACCTTGATCAGGA and CCACTGTCCCATTTCTTACG, which resulted in a 489 bp deletion beginning at Chromosome 11 position 119,234,578 bp and ending after 119,235,066 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389510 (exon 4) and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 305 and early truncation 15 amino acids later. |