| Primary Identifier | MGI:6794036 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Maco1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATATGTTGCTTGGCTTG and TTATAACCACTGCTTCCCCC, which resulted in a 505 bp deletion beginning at Chromosome 4 position 134,563,412 bp and ending after 134,563,916 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001289591 (exon 3) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 26 amino acids later. |
