| Primary Identifier | MGI:5616653 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adad1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Adad1-6098-103P6MR was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CTTTCAGAGGAATATCCAGT and AAGTTGTAGTCTGTCGAATA, which resulted in a 29 bp deletion ATATTCCTCTGAAAGTTGTAGTCTGTCGA in exon 2 beginning at Chromosome 3 positive strand approximate position 37,064,302 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 81 and an early truncation 9 amino acid later. |
