Primary Identifier | MGI:6402623 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Dytn |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGCTTTTCTTCTATAGCAG and CATTTTTCAGGGCTAACACG, which resulted in a 826 bp deletion beginning at Chromosome 1 position 63,664,040 bp and ending after 63,664,865 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001284352 and ENSMUSE00000601289 (exons 7 and 8) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 163 and early truncation 7 amino acids later. |