| Primary Identifier | MGI:6159262 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fbxo21 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fbxo21-113150J-9663M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCAGGTCTGAATGTGCCG, TTTGTGTACACCTACTCCCG, GCCTCAACCATGAGTTAGCG and CTTCACCAGGATAACTGCAG, which resulted in a 305 bp deletion beginning at Chromosome 5 position 117,979,701 bp and ending after 117,980,005 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000291184 (exon 3) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single base (G) insertion at the deletion site that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 23 amino acids later. |
