Primary Identifier | MGI:6198582 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Zfp787 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTTGGACCAGAGATAGA and TGGTCTGCAGATCTAGAGAA, which resulted in a 2331 bp deletion beginning at Chromosome 7 position 6,131,115 bp and ending after 6,133,445 bp (GRCm38/mm10). This mutation deletes (ENSMUSE00000600779) (exon 3) and 648 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 43 amino acids later due to run on after exon 2. There is a 3 bp (CCA) endogenous retention at the deletion site that will not alter the results of the deletion. |