| Primary Identifier | MGI:5897850 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Esd |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Esd-8515J-1863F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGTGCGTCTACACACAA, CTACTTTTTGAGATACATAA, GCGATGTTGAGAGATAACCT and TTATTAGCTGATGACCAACT, which resulted in a 427 bp deletion beginning at Chromosome 14 positive strand position 74,741,754 bp, TGTATCTCAAAAAGTAGAAG, and ending after TATTAGCTGATGACCAACTG at 74,742,180 bp (GRCm38/mm10). This mutation deletes exon 5 and 302 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp insertion (GT) at the site of the deletion and a single bp insertion (T) in the intron 194 bp downstream of the deletion that will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 85 and early truncation 61 amino acids later. |
