|  Help  |  About  |  Contact Us

Allele : Kcnj6<em3(IMPC)H> potassium inwardly-rectifying channel, subfamily J, member 6; endonuclease-mediated mutation 3, Harwell

Primary Identifier  MGI:6274928 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kcnj6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NTac
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 3 guide sequences ACGTCTCCCGCACATTGCCGTGG, CCGTCAGGTATCGGTACGTCTCC, CCCTGTGTAGTACCCCACGTTGA, which resulted in a Intra-exdel deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele