| Primary Identifier | MGI:6877076 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rag2 |
| Strain of Origin | NOD/ShiLtJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing is used to delete exon 3, Guide RNAs were selected to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified founder 3628 harboring a complete loss of exon 3. |
