| Primary Identifier | MGI:6156490 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem209 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0448 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATGGCTCGCTAGTAAGCTAG and CATCTGCCACTCTAATTAAG targeting the 5' side and GGTCACCAGCTGGTTTCAGC and TCACACCTGGGATCCTCATG targeting the 3' side of exon ENSMUSE00001236619 (exon 4) and ENSMUSE00001262606 (exon 5) resulting in a 2180 bp deletion of Chr6 from 30505369 to 30507548 (GRCm38). |
