| Primary Identifier | MGI:7447052 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam227a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGAGCTCTACCCCAGGAT and CAGAGGCCCTTACCACCAGC, which resulted in a 481 bp deletion beginning at Chromosome 15 position 79,643,687 bp and ending after 79,644,167 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325995 (exon 4) and 411 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 46 amino acids later. |
