| Primary Identifier | MGI:6156463 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Bdp1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0880 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GATACATTGGAGAGGTGAAG and GCCAGGCATAATGAAATACA targeting the 5' side and TAAAATGGAACCTGCCACGT and CTGCCAACTATTCACTTAAA targeting the 3' side of exons ENSMUSE00000680067 and ENSMUSE00000680066 resulting in a 2,080-bp deletion Chr13:100092104 to 100094183 and a 12-bp insertion TAGGAATAAATC (GRCm38). |
