|  Help  |  About  |  Contact Us

Allele : Egln3<em1Jianf> egl-9 family hypoxia-inducible factor 3; endonuclease-mediated mutation 1, Jian Fu

Primary Identifier  MGI:7279291 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Egln3
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting ATGCCACCAGGTAAGAGCTG) and an ssODN template (TTCTGTTCTTCTGGTCAGACCGCAGGAATCCACATGAAGTCCAGCCCTCCTATGCCACGAAGTAAGAGCTGGGGCCACAGTTCCTCTTCCAGGGTGCATACAAACCCCAGATCCCCG) with CRISPR/Cas9 technology, arginine codon 205 (AGG) was changed to lysine (AAG) (c.614G>A, p.R205K). This mutation affects the hydroxylase activity of the encoded protein.
  • mutations:
  • Single point mutation
  • synonyms:
  • EGLN3 KI,
  • EGLN3R205K,
  • EGLN3 KI,
  • EGLN3R205K
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele