Primary Identifier | MGI:6305208 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cdc5l |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCTGTCAGTGGTTATTCG and ATTGCTTCCCGTGAATAAAA, which resulted in a 344 bp deletion beginning at Chromosome 17 position 45,425,670 bp and ending after 45,426,141 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389518 (exon 4) and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 104. |