|  Help  |  About  |  Contact Us

Allele : Cdc5l<em1(IMPC)J> cell division cycle 5-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6305208 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdc5l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCTGTCAGTGGTTATTCG and ATTGCTTCCCGTGAATAAAA, which resulted in a 344 bp deletion beginning at Chromosome 17 position 45,425,670 bp and ending after 45,426,141 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389518 (exon 4) and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 104.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele