| Primary Identifier | MGI:5659636 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tusc3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tusc3-6898J-M247 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GATGGGAGTGAATCCAAGGG, ACGATCATGGAGTAGTTCCG and ATCTCGCTCTAAGTCTAAGT, which resulted in a 106 bp deletion beginning in exon 2 at Chromosome 8 positive strand position 39,046,620 bp, at CGGAACTACTCCATGATCGTCATG, and ending after CCTTGAGAAAAGCAGCAGCCTA at position 39,046,725 bp in intron 3 (GRCm38). This mutation deletes 64 bp in exon 2 and 42 bp into intron 3 removing the splice donor site. This mutation is predicted to cause an early truncation after amino acid residue 81 and early truncation after amino acid residue 83. In addition there is a 23 bp deletion in intron 2 (AAGGGAGGAACACCCTGTAACTT) Chromosome 8 positive strand position 39,046,469 - 39,046,492 bp, which is not predicted to affect the amino acid sequence. |
